Every medicine the European Commission has designated as an orphan medicine for a rare disease, on the EMA's recommendation, with its current status.
| Substance | Intended use | Status | Designated |
|---|---|---|---|
| treprostinil sodium EU/3/04/197 · now authorised as Tyvaso; Tyvaso 4 clinical trials → |
Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Active (positive) | 14 Apr 2004 |
| ciclosporin EU/3/04/196 3 clinical trials → |
Treatment of atopic keratoconjunctivitis | Withdrawn | 14 Apr 2004 |
| adeno-associated viral vector expressing lipoprotein lipase (alipogene tiparvovec) EU/3/04/194 |
Treatment of lipoprotein-lipase deficiency | Withdrawn | 9 Mar 2004 |
| Ethanol EU/3/04/191 3 clinical trials → |
Treatment of congenital venous malformations | Withdrawn | 9 Mar 2004 |
| Ethanol EU/3/04/190 3 clinical trials → |
Treatment of congenital lymphatic malformations | Withdrawn | 9 Mar 2004 |
| anti-epithelial cell adhesion molecule/anti-CD3 monoclonal antibody EU/3/04/193 |
Treatment of ovarian cancer | Active (positive) | 8 Mar 2004 |
EU/3/04/192 |
Treatment of myelodysplastic syndromes | Withdrawn | 8 Mar 2004 |
| idebenone EU/3/04/189 · now authorised as Sovrima 2 clinical trials → |
Treatment of Friedreich's ataxia | Active (positive) | 8 Mar 2004 |
| Midazolam Hydrochloride - 58 clinical trials → |
Treatment of status epilepticus | Negative | 1 Mar 2004 |
| human monoclonal hepatitis B immunoglobulins EU/3/04/187 |
Prevention of hepatitis-B re-infection following liver transplantation | Withdrawn | 23 Feb 2004 |
| treosulfan EU/3/04/186 4 clinical trials → |
Conditioning treatment prior to haematopoietic-progenitor-cell transplantation | Active (positive) | 22 Feb 2004 |
| cilengitide EU/3/03/184 |
Treatment of glioma | Withdrawn | 15 Jan 2004 |
| tacrolimus hydrate EU/3/03/185 |
Treatment of vernal keratoconjunctivitis | Withdrawn | 14 Jan 2004 |
| temocillin sodium EU/3/03/183 |
Treatment of Burkholderia cepacia lung infection in cystic fibrosis | Active (positive) | 14 Jan 2004 |
| vasoactive Intestinal Peptide EU/3/03/173 |
Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Active (positive) | 22 Dec 2003 |
| 5-Methyl-pyridine-2-sulfonic acid{6-(2-hydroxy-ethoxy)-5-(2-methoxy-phenoxy)-2-[2-(1H-tetrazol-5-yl)-pyridin-4-yl]-pyrimidin-4-yl}-amide sodium salt EU/3/03/182 |
Treatment of aneurysmal subarachnoid haemorrhage | Withdrawn | 12 Dec 2003 |
| N-acetylsarcosyl-glycyl-L-valyl-D-alloisoleucyl-L-threonyl-L-norvalyl-L-isoleucyl-L-arginyl-L-prolyl-N-ethylamide EU/3/03/181 |
Treatment of soft tissue sarcoma | Withdrawn | 12 Dec 2003 |
| 4,5-Dihydro-2-(2,4-dihydroxyphenyl)-4-methylthiazole-4(S)-carboxylic acid EU/3/03/180 |
Treatment of chronic iron overload requiring chelation therapy | Withdrawn | 12 Dec 2003 |
| recombinant human factor XIII (composed of two A subunits) EU/3/03/179 |
Treatment of hereditary factor-XIII deficiency | Withdrawn | 12 Dec 2003 |
| sildenafil citrate EU/3/03/178 13 clinical trials → |
Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Expired | 12 Dec 2003 |
| 3-(4'Aminoisoindoline-1'-one)-1-piperidine-2,6-dione (lenalidomide) EU/3/03/177 |
Treatment of multiple myeloma | Withdrawn | 12 Dec 2003 |
| recombinant antibody derivative against human CD19 and CD3 (blinatumomab) EU/3/03/176 |
Treatment of chronic lymphocytic leukaemia | Withdrawn | 1 Dec 2003 |
| recombinant antibody derivative against human CD19 and CD3 (blinatumomab) EU/3/03/175 |
Treatment of mantle cell lymphoma | Withdrawn | 1 Dec 2003 |
| Gimatecan EU/3/03/174 |
Treatment of glioma | Active (positive) | 1 Dec 2003 |
| trientine dihydrochloride EU/3/03/172 |
Treatment of Wilson's disease | Withdrawn | 24 Oct 2003 |
| human immunoglobulin EU/3/03/170 |
Treatment of polymyositis | Withdrawn | 24 Oct 2003 |
| human immunoglobulin EU/3/03/169 |
Treatment of dermatomyositis | Withdrawn | 20 Oct 2003 |
| Herpes simplex 1 virus-thymidine kinase and truncated low affinity nerve growth factor receptor transfected donor lymphocytes EU/3/03/168 |
Adjunctive treatment in haematopoietic cell transplantation | Withdrawn | 20 Oct 2003 |
| H-Tyrosine-Glycine-Phenylalanine-Glycine-Glycine-OH EU/3/03/167 |
Treatment of chronic idiopathic myelofibrosis | Withdrawn | 20 Oct 2003 |
| trabectedin EU/3/03/171 6 clinical trials → |
Treatment of ovarian cancer | Expired | 17 Oct 2003 |
| Eculizumab EU/3/03/166 12 clinical trials → |
Treatment of paroxysmal nocturnal haemoglobinuria | Expired | 17 Oct 2003 |
| nolatrexed EU/3/03/165 |
Treatment of hepatocellular carcinoma | Withdrawn | 2 Oct 2003 |
| 5,6,7,8-Tetrahydrobiopterin EU/3/03/163 |
Treatment of hyperphenylalaninaemia | Active (positive) | 2 Oct 2003 |
| yttrium (90Y) antiferritin polyclonal antibodies EU/3/03/162 |
Treatment of Hodgkin's lymphoma | Active (positive) | 2 Oct 2003 |
| antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/161 |
Treatment of neovascular glaucoma | Active (positive) | 2 Oct 2003 |
| antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/03/160 |
Treatment of retinopathy of prematurity | Active (positive) | 2 Oct 2003 |
| prasterone EU/3/03/156 |
Treatment of adrenal insufficiency | Active (positive) | 28 Jul 2003 |
| recombinant human insulin-like growth factor-I;recombinant human insulin-like growth factor binding protein-3 EU/3/03/159 |
Treatment of primary growth hormone insensitivity syndrome (laron syndrome) | Withdrawn | 9 Jul 2003 |
| recombinant human arylsulfatase A EU/3/03/158 |
treatment of metachromatic leukodystrophy | Withdrawn | 9 Jul 2003 |
| recombinant dog gastric lipase EU/3/03/157 |
Treatment of cystic fibrosis | Active (positive) | 9 Jul 2003 |
| murine anti-idiotypic antibody against OC125 antibody against CA125 antigen EU/3/03/155 |
Treatment of ovarian cancer | Withdrawn | 9 Jul 2003 |
| Hydroxyurea EU/3/03/154 12 clinical trials → |
Treatment of sickle cell syndrome | Expired | 9 Jul 2003 |
| Herpes simplex virus lacking infected cell protein 34.5 EU/3/03/153 |
Treatment of glioma | Active (positive) | 9 Jul 2003 |
| Engineered protein inhibitor of human neutrophil elastase EU/3/03/152 |
Treatment of cystic fibrosis | Withdrawn | 9 Jul 2003 |
| aplidine EU/3/03/151 |
Treatment of acute lymphoblastic leukaemia | Withdrawn | 9 Jul 2003 |
| adenovirus-interferon gamma-coding DNA sequence EU/3/03/150 |
Treatment of cutaneous T-cell lymphoma | Withdrawn | 9 Jul 2003 |
| Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulfate EU/3/03/149 |
Treatment of pancreatic cancer in combination with ifosfamide | Active (positive) | 30 Jun 2003 |
| chimeric anti-interleukin-6 monoclonal antibody EU/3/03/148 |
Treatment of renal-cell carcinoma | Withdrawn | 30 Jun 2003 |
| amiloride hydrochloride dihydrate EU/3/03/147 2 clinical trials → |
Treatment of cystic fibrosis | Withdrawn | 30 Jun 2003 |
| aldesleukin EU/3/03/146 42 clinical trials → |
Treatment of renal-cell carcinoma | Withdrawn | 30 Jun 2003 |
| 5-10-Methylene-tetrahydrofolate EU/3/03/143 |
Treatment pancreatic cancer in combination with 5-fluorouracil | Withdrawn | 11 Jun 2003 |
| rubitecan EU/3/03/145 · now authorised as Orathecin |
Treatment of pancreatic cancer | Active (positive) | 10 Jun 2003 |
| Liarozole EU/3/03/144 |
Treatment of congenital ichthyoses | Withdrawn | 10 Jun 2003 |
| Iodine (131I) Anti-CEA sheep-human chimeric monoclonal antibody EU/3/03/142 |
Treatment of pancreatic cancer | Withdrawn | 8 May 2003 |
| 2-Chloro-9-[2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine EU/3/03/141 |
Treatment of acute myeloid leukaemia | Withdrawn | 8 May 2003 |
| alpha-1-acid glycoprotein EU/3/03/138 |
Treatment of tricyclic anti-depressants poisoning | Withdrawn | 20 Mar 2003 |
| Bosentan EU/3/03/139 3 clinical trials → |
Treatment of systemic sclerosis (scleroderma) | Withdrawn | 18 Mar 2003 |
| tobramycin EU/3/03/140 2 clinical trials → |
Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | Expired | 17 Mar 2003 |
| icatibant acetate EU/3/03/133 |
Treatment of angioedema | Expired | 18 Feb 2003 |
| Caffeine citrate EU/3/03/132 11 clinical trials → |
Treatment of primary apnoea of premature newborns | Expired | 18 Feb 2003 |
| tositumomab EU/3/03/137 |
Treatment of follicular lymphoma | Withdrawn | 14 Feb 2003 |
| Iodine (131I) tositumomab EU/3/03/136 |
Treatment of follicular lymphoma | Withdrawn | 14 Feb 2003 |
| decitabine EU/3/03/135 51 clinical trials → |
Treatment of myelodysplastic syndromes | Active (positive) | 14 Feb 2003 |
| Iodine (123I) Serum Amyloid P EU/3/03/134 |
Diagnosis of the extent of histologically proven amyloidosis | Withdrawn | 14 Feb 2003 |
| sodium oxybate EU/3/02/131 |
Treatment of narcolepsy | Withdrawn | 3 Feb 2003 |
| carboxypeptidase G2 (glucarpidase) EU/3/02/128 · now authorised as Voraxaze; Voraxaze |
Adjunctive treatment in patients at risk of methotrexate toxicity | Active (positive) | 3 Feb 2003 |
| G17(9) gastrin-Diphtheria Toxoid Conjugate EU/3/02/130 |
Treatment of gastric cancer | Active (positive) | 28 Jan 2003 |
| G17(9) gastrin-Diphtheria Toxoid Conjugate EU/3/02/129 |
Treatment of pancreatic cancer | Active (positive) | 24 Jan 2003 |
| 3,4-diaminopyridine phosphate (amifampridine) EU/3/02/124 |
Treatment of Lambert-Eaton myasthenic syndrome | Withdrawn | 19 Dec 2002 |
| cholic acid EU/3/02/127 |
Treatment of inborn errors in primary bile acid synthesis | Active (positive) | 18 Dec 2002 |
| recombinant inhibitor of human plasma kallikrein EU/3/02/126 |
Treatment of angioedema | Withdrawn | 18 Dec 2002 |
| monoclonal antibody to human interleukin-6 EU/3/02/125 |
Treatment of post-transplantation lymphoproliferative disorders | Withdrawn | 18 Dec 2002 |
| Mycobacterial cell wall complex - |
Treatment of carcinoma in situ of the urinary bladder | Negative | 18 Dec 2002 |
| anti-CD 147 murine monoclonal IgM EU/3/02/123 |
Treatment of steroid resistant graft versus host disease (GvHD) | Withdrawn | 14 Nov 2002 |
| 5-aminolevulinic acid hydrochloride EU/3/02/121 |
Intra-operative photodynamic diagnosis of residual glioma | Expired | 14 Nov 2002 |
| Etilefrine EU/3/02/122 |
Treatment of low-flow priapism | Active (positive) | 13 Nov 2002 |
| Duramycin EU/3/02/120 |
Treatment of cystic fibrosis | Active (positive) | 13 Nov 2002 |
| Iodine (131I) anti-nucleohistone H1 chimeric biotinylated monoclonal antibody EU/3/02/119 |
Treatment of glioma | Withdrawn | 13 Nov 2002 |
| recombinant glycoprotein gp350 of Epstein-Barr Virus EU/3/02/118 |
Prevention of post-transplantation lympho-proliferative disorders | Active (positive) | 22 Oct 2002 |
| boswellia serrata EU/3/02/117 |
Treatment of peritumoral oedema derived from brain tumours | Withdrawn | 21 Oct 2002 |
| autologous Renal Cell Tumour Vaccine EU/3/02/116 |
Treatment of renal-cell carcinoma | Active (positive) | 21 Oct 2002 |
EU/3/02/115 · now authorised as Winfuran |
Treatment of uraemic pruritus | Active (positive) | 11 Sep 2002 |
| myristolated-peptidyl-recombinant human CD59 EU/3/02/114 |
Treatment of paroxysmal nocturnal haemoglobinuria | Withdrawn | 11 Sep 2002 |
| mitotane EU/3/02/113 |
Treatment of adrenal cortical carcinoma | Withdrawn | 11 Sep 2002 |
| Doxorubicin carbon;iron magnetically targeted microparticles EU/3/02/112 |
Treatment of hepatocellular carcinoma | Withdrawn | 11 Sep 2002 |
| benzoic acid, sodium salt EU/3/02/111 · now authorised as Prohippur |
Treatment of non-ketotic hyperglycinaemia | Active (positive) | 11 Sep 2002 |
| thymalfasin EU/3/02/110 8 clinical trials → |
Treatment of hepatocellular carcinoma | Active (positive) | 30 Jul 2002 |
| oregovomab EU/3/02/109 4 clinical trials → |
Treatment of ovarian cancer | Withdrawn | 30 Jul 2002 |
| myristolated-peptidyl-recombinant SCR1-3 of human complement receptor type I EU/3/02/108 |
Prevention of post transplantation graft dysfunction | Withdrawn | 30 Jul 2002 |
| proteolytic enzymes enriched in bromelain EU/3/02/107 |
Treatment of partial deep dermal and full-thickness burns | Expired | 30 Jul 2002 |
| antisense NF-kBp65 oligonucleotide EU/3/02/106 |
Treatment of active ulcerative colitis | Withdrawn | 30 Jul 2002 |
| chlorproguanil hydrochloride;dapsone - 2 clinical trials → |
Treatment of acute uncomplicated plasmodium falciparum malaria | Negative | 26 Jul 2002 |
| carbamic acid (common)/[[4-[[3-[[4-[1-(4-hydroxyphenyl)-1-methyl-ethyl]phenoxy]methyl]phenyl]methoxy]-phenyl]iminomethyl]-,ethyl ester (amelubant) EU/3/02/105 |
Treatment of cystic fibrosis | Withdrawn | 26 Jun 2002 |
| Miltefosine EU/3/02/104 |
Treatment of visceral leishmaniasis | Active (positive) | 12 Jun 2002 |
| recombinant human porphobilinogen deaminase EU/3/02/103 |
Treatment of acute intermittent porphyria | Withdrawn | 12 Jun 2002 |
| mitotane EU/3/02/102 |
Treatment of adrenal cortical carcinoma | Expired | 12 Jun 2002 |
| pseudomonas exotoxin (domains II/III)-interleukin 13 chimeric protein EU/3/02/101 |
Treatment of glioma | Withdrawn | 30 Apr 2002 |
| recombinant human alpha-1 antitrypsin EU/3/02/100 |
Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency | Withdrawn | 30 Apr 2002 |
| bryostatin-1 EU/3/02/099 |
Treatment of oesophageal cancer | Withdrawn | 30 Apr 2002 |
| Epothilone B EU/3/02/098 |
Treatment of ovarian cancer | Withdrawn | 22 Mar 2002 |
Every row is copied from the EMA's orphan designations data, reproduced with acknowledgement of the source. Each substance links to its official EMA page.
A daily job downloads the EMA's orphan designations JSON report and lists every designation, newest first. No AI drafting and no editorial pass. See our editorial standards. The the EMA data on this page was last retrieved on 27 Sep 2026.