Every medicine the European Commission has designated as an orphan medicine for a rare disease, on the EMA's recommendation, with its current status.
| Substance | Intended use | Status | Designated |
|---|---|---|---|
| cardiotrophin-1 EU/3/06/396 |
Prevention of the ischemia/reperfusion injury associated with solid organ transplantation | Active (positive) | 28 Aug 2006 |
| aviptadil EU/3/06/395 |
Treatment of acute lung Injury | Active (positive) | 28 Aug 2006 |
| autologous tumour-derived immunoglobulin idiotype coupled to keyhole limpet hemocyanin EU/3/06/394 · now authorised as Lympreva |
Treatment of follicular lymphoma | Active (positive) | 28 Aug 2006 |
| human monoclonal antibody against inhibitory killer cell lg-like receptors (1-7 F9) EU/3/06/392 |
Treatment of acute myeloid leukaemia | Withdrawn | 28 Aug 2006 |
| amphotericin B EU/3/06/391 2 clinical trials → |
Prevention of pulmonary fungal infection in patients deemed at risk | Withdrawn | 28 Aug 2006 |
| 4-Amino-(6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride (ronopterin) EU/3/06/390 |
Treatment of moderate and severe traumatic brain injury | Active (positive) | 28 Aug 2006 |
| Lestaurtinib EU/3/06/389 |
Treatment of acute myeloid leukaemia | Withdrawn | 25 Jul 2006 |
| becatecarin EU/3/06/388 |
Treatment of cancers of the biliary tree | Withdrawn | 25 Jul 2006 |
| amikacin sulfate EU/3/06/387 5 clinical trials → |
Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | Active (positive) | 25 Jul 2006 |
| 4-[123I] Iodo-L-phenylalanine EU/3/06/386 |
Diagnosis of glioma | Active (positive) | 25 Jul 2006 |
| 2-(4-(Diethylamino) phenyl)-6-methyl-2H-benzo[d][1,2,3] triazol-5-amine EU/3/06/385 |
Treatment of Duchenne muscular dystrophy | Withdrawn | 25 Jul 2006 |
| Human telomerase reverse transcriptase peptide (611-626) (tertomotide) EU/3/06/384 |
Treatment of pancreatic cancer | Withdrawn | 25 Jul 2006 |
| autologous CD34+ cells transduced with retroviral vector containing the human gp91 (phox) gene EU/3/06/393 |
Treatment of chronic granulomatous disease | Withdrawn | 13 Jul 2006 |
| siplizumab EU/3/06/383 2 clinical trials → |
Treatment of T-cell and NK-cell neoplasms | Withdrawn | 29 Jun 2006 |
| pazopanib hydrochloride EU/3/06/382 9 clinical trials → |
Treatment of renal-cell carcinoma | Withdrawn | 29 Jun 2006 |
| human monoclonal antibody against Pseudomonas aeruginosa serotype O11 (Panobacumab) EU/3/06/381 |
Treatment of pneumonia caused by serotype O11 Pseudomonas aeruginosa | Active (positive) | 29 Jun 2006 |
| Diphenylcyclopropenone EU/3/06/380 |
Treatment of alopecia universalis | Withdrawn | 29 Jun 2006 |
| Diphenylcyclopropenone EU/3/06/379 |
Treatment of alopecia totalis | Withdrawn | 29 Jun 2006 |
| mecasermin rinfabate EU/3/06/378 |
Treatment of primary insulin-like growth factor-1 deficiency due to molecular or genetic defects | Withdrawn | 20 Jun 2006 |
| mecasermin rinfabate EU/3/06/377 |
Treatment of growth hormone (GH) gene deletion who have developed neutralizing antibodies to GH | Withdrawn | 20 Jun 2006 |
| decitabine EU/3/06/370 51 clinical trials → |
Treatment of acute myeloid leukaemia | Active (positive) | 8 Jun 2006 |
| recombinant P-selectin glycoprotein immunoglobulin EU/3/06/376 |
Prevention of post transplantation graft dysfunction | Active (positive) | 22 May 2006 |
| nilotinib EU/3/06/375 12 clinical trials → |
Treatment of chronic myeloid leukaemia | Expired | 22 May 2006 |
| Methoxsalen EU/3/06/374 |
Treatment of graft-versus-host disease | Active (positive) | 22 May 2006 |
| Mecasermin EU/3/06/373 |
Treatment of primary insulin-like growth factor-1 deficiency due to molecular or genetic defects | Expired | 22 May 2006 |
| hydrocortisone EU/3/06/372 18 clinical trials → |
Treatment of adrenal insufficiency | Expired | 22 May 2006 |
| heparin (sodium) EU/3/06/371 15 clinical trials → |
Treatment of cystic fibrosis | Active (positive) | 22 May 2006 |
| bilayer engineered skin composed of keratinocytes from the patient (autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix EU/3/06/369 |
Treatment of epidermolysis bullosa | Active (positive) | 22 May 2006 |
| 1-Deoxygalactonojirimycin hydrochloride EU/3/06/368 |
Treatment of Fabry disease | Expired | 22 May 2006 |
| Parathyroid hormone (1-34) transglutaminase fusion protein fibrin matrix complex EU/3/06/367 |
Treatment of solitary bone cysts | Active (positive) | 11 Apr 2006 |
| tobramycin EU/3/06/366 2 clinical trials → |
Treatment of Pseudomonas aeruginosa lung infection in cystic fibrosis | Withdrawn | 11 Apr 2006 |
| sorafenib tosilate EU/3/06/364 |
Treatment of hepatocellular carcinoma | Expired | 11 Apr 2006 |
| 4-[131I] Iodo-L-phenylalanine EU/3/06/363 |
Treatment of glioma | Active (positive) | 11 Apr 2006 |
| human heterologous liver cells EU/3/06/362 |
Treatment of acute liver failure | Active (positive) | 11 Apr 2006 |
| Glutathione EU/3/06/361 |
Treatment of cystic fibrosis | Withdrawn | 11 Apr 2006 |
| temsirolimus EU/3/06/365 4 clinical trials → |
Treatment of renal-cell carcinoma | Expired | 6 Apr 2006 |
| ciclosporin EU/3/06/360 · now authorised as Verkazia; Vekacia; Vekacia 3 clinical trials → |
Treatment of vernal keratoconjunctivitis | Active (positive) | 6 Apr 2006 |
| adeno-associated viral vector containing the human calpain 3 gene EU/3/06/359 |
Treatment of calpainopathy | Withdrawn | 6 Apr 2006 |
| human monoclonal antibody against HLA-DR EU/3/06/358 |
Treatment of multiple myeloma | Withdrawn | 28 Feb 2006 |
| zosuquidar trihydrochloride EU/3/06/355 |
Treatment of acute myeloid leukaemia | Active (positive) | 17 Feb 2006 |
| oxalobacter formigenes strain HC-1 EU/3/06/354 |
Treatment of primary hyperoxaluria | Active (positive) | 17 Feb 2006 |
| 2'-O-methyl-phosphorothioate oligonucleotide EU/3/06/357 |
Treatment of Duchenne muscular dystrophy | Withdrawn | 16 Feb 2006 |
| 4-Amino-5-oxo-4 (pyridinium-1-ylmethyl) proline EU/3/06/356 |
Treatment of renal-cell carcinoma | Active (positive) | 16 Feb 2006 |
| 26 base single stranded phosphodiester DNA oligonucleotide EU/3/06/353 |
Treatment of renal-cell carcinoma | Withdrawn | 16 Feb 2006 |
| 26 base single stranded phosphodiester DNA oligonucleotide EU/3/06/352 |
Treatment of pancreatic cancer | Withdrawn | 16 Feb 2006 |
| miglustat EU/3/06/351 3 clinical trials → |
Treatment of Niemann-Pick's disease, type C | Expired | 16 Feb 2006 |
| alpha-1 proteinase inhibitor EU/3/06/350 |
Treatment of emphysema secondary to congenital alpha-1 antitrypsin deficiency | Withdrawn | 16 Feb 2006 |
| apomorphine hydrochloride EU/3/06/349 |
Treatment of off-periods in Parkinson's disease not responding to oral treatment | Active (positive) | 16 Feb 2006 |
| purified inactivated Japanese encephalitis SA14-4-2 virus vaccine EU/3/05/348 |
Prevention of Japanese encephalitis | Withdrawn | 24 Jan 2006 |
| human monoclonal antibody against HLA-DR EU/3/05/347 |
Treatment of chronic lymphocytic leukaemia | Withdrawn | 24 Jan 2006 |
| E. Coli heat-shock protein 70 with bovine retinal S-antigen EU/3/05/346 |
Treatment of autoimmune uveitis | Active (positive) | 24 Jan 2006 |
| Lentiviral vector containing the human Wiskott Aldrich Syndrome Protein gene EU/3/05/345 |
Treatment of Wiskott-Aldrich syndrome | Withdrawn | 24 Jan 2006 |
| vandetanib EU/3/05/344 3 clinical trials → |
Treatment of medullary thyroid carcinoma | Withdrawn | 24 Jan 2006 |
| Denufosol tetrasodium EU/3/05/342 |
Treatment of cystic fibrosis | Withdrawn | 23 Dec 2005 |
| Imexon EU/3/05/341 |
Treatment of ovarian cancer | Active (positive) | 23 Dec 2005 |
| imatinib mesilate EU/3/05/340 32 clinical trials → |
Treatment of myelodysplastic / myeloproliferative diseases | Expired | 23 Dec 2005 |
| dasatinib EU/3/05/339 26 clinical trials → |
Treatment of chronic myeloid leukaemia | Expired | 23 Dec 2005 |
| dasatinib EU/3/05/338 26 clinical trials → |
Treatment of acute lymphoblastic leukaemia | Expired | 23 Dec 2005 |
| heparin sodium EU/3/05/337 15 clinical trials → |
Treatment of cystic fibrosis | Withdrawn | 23 Dec 2005 |
| brostallicin EU/3/05/336 |
Treatment of soft tissue sarcoma | Withdrawn | 23 Dec 2005 |
| Human Staphylococcus aureus immunoglobulin;human Staphylococcus epidermidis polyclonal immunoglobulin EU/3/05/335 |
Late onset sepsis in premature infants of less or equal than 32 weeks of gestational age | Withdrawn | 14 Dec 2005 |
| eptacog alfa (activated) EU/3/05/333 |
Treatment of diffuse alveolar haemorrhage | Withdrawn | 14 Dec 2005 |
| 1,2-Bis(methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine EU/3/05/332 |
Treatment of acute myeloid leukaemia | Active (positive) | 14 Dec 2005 |
| Mannitolum EU/3/05/325 |
Treatment of cystic fibrosis | Expired | 7 Nov 2005 |
| bacterial lipase (burlulipase) EU/3/05/323 |
Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency | Active (positive) | 7 Nov 2005 |
| tilarginine acetate EU/3/05/330 |
Treatment of cardiogenic shock | Withdrawn | 3 Nov 2005 |
| Human Staphylococcus aureus immunoglobulin EU/3/05/319 |
Treatment of Staphylococcus aureus bacteraemia | Active (positive) | 3 Nov 2005 |
| recombinant microbial lipase EU/3/05/331 |
Treatment of malabsorption due to exocrine pancreatic enzyme insufficiency | Withdrawn | 28 Oct 2005 |
| Peptide 144 TGF-beta1-inhibitor (TSLDASIIWAMMQN) EU/3/05/329 |
Treatment of localised scleroderma | Active (positive) | 28 Oct 2005 |
| (E)-(1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23- tetraazabicyclo[8.7.6]tricos-16-ene-3,6,9,19,22-pentone EU/3/05/328 · now authorised as Istodax |
Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Active (positive) | 28 Oct 2005 |
| oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt EU/3/05/327 |
Treatment of glioma | Active (positive) | 28 Oct 2005 |
| Peptide 144 TGF-beta1-inhibitor (TSLDASIIWAMMQN) EU/3/05/326 |
Treatment of systemic sclerosis | Active (positive) | 28 Oct 2005 |
| levamisole hydrochloride EU/3/05/324 · now authorised as Elmisol |
Treatment of nephrotic syndrome | Active (positive) | 28 Oct 2005 |
| alfimeprase EU/3/05/322 |
Treatment of acute peripheral arterial occlusion | Withdrawn | 28 Oct 2005 |
| (1R, 2R, 4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R, 27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pent… EU/3/05/321 |
Treatment of primary malignant bone tumours | Withdrawn | 28 Oct 2005 |
| imatinib mesilate EU/3/05/320 32 clinical trials → |
Treatment of chronic eosinophilic leukaemia and the hypereosinophilic syndrome | Expired | 28 Oct 2005 |
| recombinant modified vaccinia virus Ankara expressing tuberculosis antigen 85A EU/3/05/318 |
Prevention of tuberculosis disease in Bacille-Calmette-Guerin-vaccinated individuals | Withdrawn | 28 Oct 2005 |
| anti-CD3 mAb (SPV-T3a)-ricin A chain fusion protein;anti-CD7 mAb (WT1)-ricin A chain fusion protein EU/3/05/317 |
Treatment of graft-versus-host disease | Active (positive) | 26 Aug 2005 |
| 2-{4-[(5,6-Diphenylpyrazin-2-yl)(isopropyl)amino]butoxy}-N-(methylsulfonyl)acetamide EU/3/05/316 |
Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Withdrawn | 26 Aug 2005 |
EU/3/05/315 |
Treatment of progressive myoclonic epilepsies | Withdrawn | 26 Aug 2005 |
| (1R,2S) 6-bromo-alpha-[2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol bedaquiline EU/3/05/314 |
Treatment of tuberculosis | Withdrawn | 26 Aug 2005 |
| autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene EU/3/05/313 · now authorised as Strimvelis |
Treatment of severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency | Active (positive) | 26 Aug 2005 |
| (1R, 2R, 4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R, 27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pent… EU/3/05/312 |
Treatment of soft tissue sarcoma | Withdrawn | 26 Aug 2005 |
| troxacitabine EU/3/05/311 |
Treatment of acute myeloid leukaemia | Withdrawn | 26 Aug 2005 |
| treprostinil diethanolamine EU/3/05/310 · now authorised as Orepaxam |
Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Active (positive) | 26 Aug 2005 |
| sodium valproate EU/3/05/309 3 clinical trials → |
Treatment of 5q spinal muscular atrophy | Withdrawn | 26 Aug 2005 |
| sapropterin EU/3/05/308 |
Treatment of hyperphenylalaninaemia | Withdrawn | 26 Aug 2005 |
| Mecasermin EU/3/05/307 |
Treatment of primary growth hormone insensitivity syndrome | Active (positive) | 26 Aug 2005 |
| imatinib mesilate EU/3/05/306 32 clinical trials → |
Treatment of mastocytosis | Withdrawn | 26 Aug 2005 |
| imatinib mesilate EU/3/05/305 32 clinical trials → |
Treatment of dermatofibrosarcoma protuberans | Expired | 26 Aug 2005 |
| imatinib mesilate EU/3/05/304 32 clinical trials → |
Treatment of acute lymphoblastic leukaemia | Expired | 26 Aug 2005 |
| human autologous mesenchymal adult stem cells extracted from adipose tissue EU/3/05/303 |
Treatment of anal fistula | Withdrawn | 26 Aug 2005 |
| Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower EU/3/05/302 |
Treatment of sickle cell disease | Active (positive) | 26 Aug 2005 |
| chimeric monoclonal antibody to shiga toxin 1 and 2 EU/3/05/301 |
Treatment of shiga-toxin-producing bacterial infection | Active (positive) | 26 Aug 2005 |
| nemorubicin hydrochloride EU/3/05/300 |
Treatment of hepatocellular carcinoma | Active (positive) | 27 Jul 2005 |
| 4-Imino-1, 3-diazobicyclo-[3.1.0]-hexan-2-one EU/3/05/299 |
Treatment of pancreatic cancer | Active (positive) | 27 Jul 2005 |
| mifepristone EU/3/05/298 3 clinical trials → |
Treatment of Cushing's syndrome secondary to ectopic ACTH secretion | Withdrawn | 27 Jul 2005 |
| adeno-associated viral vector containing a modified U7 snRNA gene EU/3/05/297 |
Treatment of Duchenne muscular dystrophy | Withdrawn | 27 Jul 2005 |
| hydrocortisone EU/3/05/296 18 clinical trials → |
Treatment of congenital adrenal hyperplasia | Active (positive) | 27 Jul 2005 |
| Hepatitis C immunoglobulin EU/3/05/295 |
Prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients | Active (positive) | 8 Jul 2005 |
Every row is copied from the EMA's orphan designations data, reproduced with acknowledgement of the source. Each substance links to its official EMA page.
A daily job downloads the EMA's orphan designations JSON report and lists every designation, newest first. No AI drafting and no editorial pass. See our editorial standards. The the EMA data on this page was last retrieved on 27 Sep 2026.