Every medicine the European Commission has designated as an orphan medicine for a rare disease, on the EMA's recommendation, with its current status.
| Substance | Intended use | Status | Designated |
|---|---|---|---|
| adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/486 |
Treatment of retinitis pigmentosa | Active (positive) | 14 Nov 2007 |
| Interferon gamma EU/3/07/491 |
Treatment of idiopathic pulmonary fibrosis | Active (positive) | 29 Oct 2007 |
| human autologous bone-forming cells derived from bone marrow stem cells EU/3/07/490 |
Treatment of non-traumatic osteonecrosis | Withdrawn | 29 Oct 2007 |
| ciclosporin EU/3/07/489 3 clinical trials → |
Treatment of herpes simplex virus stromal keratitis | Withdrawn | 29 Oct 2007 |
| methotrexate EU/3/07/495 97 clinical trials → |
Treatment of acute lymphoblastic leukaemia | Active (positive) | 24 Oct 2007 |
| Isofagomine tartrate EU/3/07/493 |
Treatment of Gaucher disease | Withdrawn | 23 Oct 2007 |
| alvocidib EU/3/07/485 |
Treatment of chronic lymphocytic leukaemia | Active (positive) | 23 Oct 2007 |
| 4-[3,5-Bis(trimethylsilyl)benzamido] benzoic acid EU/3/07/497 |
Treatment of hepatocellular carcinoma | Withdrawn | 22 Oct 2007 |
| Mercaptopurine EU/3/07/496 · now authorised as Loulla 15 clinical trials → |
Treatment of acute lymphoblastic leukaemia | Active (positive) | 22 Oct 2007 |
| Iodine (131I) chlorotoxin EU/3/07/492 |
Treatment of glioma | Withdrawn | 22 Oct 2007 |
| adenovirus associated viral vector serotype 4 containing the human RPE65 gene EU/3/07/484 |
Treatment of Leber's congenital amaurosis | Active (positive) | 22 Oct 2007 |
| amonafide L-malate EU/3/07/483 |
Treatment of acute myeloid leukaemia | Withdrawn | 22 Oct 2007 |
| ciclosporin EU/3/07/455 3 clinical trials → |
Prevention of corneal graft rejection | Withdrawn | 22 Oct 2007 |
| sulfonated monophosphorylated mannose oligosaccharide EU/3/07/482 |
Treatment of hepatocellular carcinoma | Withdrawn | 14 Sep 2007 |
| R-salbutamol sulfate EU/3/07/481 |
Treatment of cutaneus forms of lupus erythromatosus | Active (positive) | 14 Sep 2007 |
| naptumomab estafenatox EU/3/07/480 |
Treatment of renal-cell carcinoma | Active (positive) | 14 Sep 2007 |
| N-adamantanyl-N'-Geranyl-ethylenediamine EU/3/07/479 |
Treatment of tuberculosis | Active (positive) | 14 Sep 2007 |
| N-(2-amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide (mocetinostat) EU/3/07/478 |
Treatment of Hodgkin's lymphoma | Withdrawn | 14 Sep 2007 |
| 4-Amino-1-[5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-ß-D-arabinofuranosyl]-2(1H)-pyrimidinone EU/3/07/477 |
Treatment of hepatocellular carcinoma | Active (positive) | 14 Sep 2007 |
| 5'-O-(trans-9"-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine EU/3/07/476 |
Treatment of acute myeloid leukaemia | Active (positive) | 14 Sep 2007 |
| alginate oligosaccharide (G-block) fragment EU/3/07/475 |
Treatment of cystic fibrosis | Active (positive) | 14 Sep 2007 |
| alpha-1 proteinase inhibitor EU/3/07/474 |
Treatment of cystic fibrosis | Withdrawn | 14 Sep 2007 |
| aviptadil EU/3/07/473 |
Treatment of sarcoidosis | Active (positive) | 14 Sep 2007 |
| Cyclo {{(E,Z)-(2S,3R,4R)-3-hydroxy-4-methyl-2-(methylamino)nona-6,8-dienoyl}-L-2-aminobutyryl-N-methyl-glycyl-N-methyl-L-leucyl-L-valyl-N-methyl-L-leucyl-L-ala… EU/3/07/472 |
Treatment of chronic non-infectious uveitis | Withdrawn | 14 Sep 2007 |
| human coagulation factor X EU/3/07/471 · now authorised as Coagadex |
Treatment of hereditary factor X deficiency | Active (positive) | 14 Sep 2007 |
| human heterologous liver cells EU/3/07/470 · now authorised as Heparesc |
Treatment of ornithine-transcarbamylase deficiency | Active (positive) | 14 Sep 2007 |
| ciprofloxacin EU/3/07/469 11 clinical trials → |
Treatment of cystic fibrosis | Withdrawn | 3 Aug 2007 |
| dihydroartemisinin;piperaquine EU/3/07/468 5 clinical trials → |
Treatment of malaria | Withdrawn | 3 Aug 2007 |
| eltrombopag olamine EU/3/07/467 14 clinical trials → |
Treatment of idiopathic thrombocytopenic purpura | Withdrawn | 3 Aug 2007 |
| Human plasminogen EU/3/07/461 |
Treatment of ligneous conjunctivitis | Active (positive) | 3 Aug 2007 |
| L-threo-3,4-dihydroxyphenylserine EU/3/07/466 |
Treatment of orthostatic hypotension in patients with multiple system atrophy | Withdrawn | 2 Aug 2007 |
| L-threo-3,4-dihydroxyphenylserine EU/3/07/465 |
Treatment of orthostatic hypotension in patients with pure autonomic failure | Withdrawn | 2 Aug 2007 |
| panobinostat lactate EU/3/07/464 |
Treatment of cutaneous T-cell lymphoma | Withdrawn | 2 Aug 2007 |
| pyridoxalated hemoglobin polyoxyethylene EU/3/07/463 |
Treatment of cardiogenic shock | Active (positive) | 2 Aug 2007 |
| recombinant human soluble Fc-gamma receptor II b EU/3/07/462 |
Treatment of idiopathic thrombocytopenic purpura | Withdrawn | 2 Aug 2007 |
| arsenic trioxide EU/3/07/460 11 clinical trials → |
Treatment of acute myeloid leukaemia | Withdrawn | 2 Aug 2007 |
| 1-{3-[3-(4-Chlorophenyl)propoxy]propyl}piperidine, hydrochloride EU/3/07/459 · now authorised as Wakix |
Treatment of narcolepsy | Active (positive) | 10 Jul 2007 |
| Fampridine EU/3/07/458 2 clinical trials → |
Treatment of Guillain-Barré syndrome | Withdrawn | 10 Jul 2007 |
| Lusupultide EU/3/07/457 |
Treatment of aspiration pneumonitis requiring intubation and mechanical ventilation | Withdrawn | 10 Jul 2007 |
| rilonacept EU/3/07/456 |
Treatment of cryopirin-associated periodic syndromes | Withdrawn | 10 Jul 2007 |
| recombinant adeno-associated viral vector containing human acid alfa-glucosidase-gene EU/3/07/454 |
Treatment of glycogen storage disease type II (Pompe's disease) | Withdrawn | 9 Jul 2007 |
| R-1-[2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H-1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea (netazepide) EU/3/07/452 |
Treatment of gastric carcinoid | Active (positive) | 14 Jun 2007 |
| recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 EU/3/07/453 · now authorised as Alprolix |
Treatment of haemophilia B (congenital factor IX deficiency) | Active (positive) | 8 Jun 2007 |
| cisplatin EU/3/07/451 473 clinical trials → |
Treatment of pancreatic cancer | Active (positive) | 8 Jun 2007 |
| 5(S)-(2'-hydroxy ethoxy)-20(S)-Camptothecin EU/3/07/450 |
Treatment of osteosarcoma | Withdrawn | 8 Jun 2007 |
| everolimus EU/3/07/449 53 clinical trials → |
Treatment of renal-cell carcinoma | Withdrawn | 5 Jun 2007 |
| talactoferrinum alfa EU/3/07/448 |
Treatment of renal-cell carcinoma | Active (positive) | 5 Jun 2007 |
| antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) EU/3/07/445 |
Prevention of corneal graft rejection | Active (positive) | 17 Apr 2007 |
| nilotinib hydrochloride monohydrate EU/3/07/447 12 clinical trials → |
Treatment of gastrointestinal stromal tumours | Withdrawn | 13 Apr 2007 |
| autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA EU/3/07/446 · now authorised as Libmeldy |
treatment of metachromatic leukodystrophy | Active (positive) | 13 Apr 2007 |
| pralatrexate EU/3/07/444 · now authorised as Folotyn; Folotyn 3 clinical trials → |
Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Active (positive) | 13 Apr 2007 |
| Elafin EU/3/07/443 |
Treatment of pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension | Active (positive) | 20 Mar 2007 |
| enzastaurin hydrochloride EU/3/07/442 |
Treatment of diffuse large B-cell lymphoma | Withdrawn | 20 Mar 2007 |
| hydrocortisone EU/3/07/441 18 clinical trials → |
Treatment of adrenal insufficiency | Withdrawn | 20 Mar 2007 |
| recombinant adeno-associated viral vector containing human alpha-1 antitrypsin gene EU/3/07/440 |
Treatment of congenital alpha-1 antitrypsin deficiency | Active (positive) | 20 Mar 2007 |
| recombinant human monoclonal antibody to human IL-1beta of the IgG1/K class EU/3/07/439 |
Treatment of cryopirin-associated periodic syndromes (FCUS, MWS, and NOMID) | Withdrawn | 20 Mar 2007 |
| zanolimumab EU/3/07/438 |
Treatment of peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) | Active (positive) | 20 Mar 2007 |
| idebenone EU/3/07/437 · now authorised as Puldysa 2 clinical trials → |
Treatment of Duchenne muscular dystrophy | Active (positive) | 20 Mar 2007 |
| eptacog alfa (activated) EU/3/07/436 |
Treatment of post-neonatal intracerebral haemorrhage | Withdrawn | 20 Mar 2007 |
| N-3[[4-(aminoiminomethyl)benzoyl]amino]propyl]-1-[[2,4—dichloro-3-[[2,4-dimethyl-8-quinolinyl)oxy]methyl]phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(me… EU/3/04/188 |
Treatment of moderate and severe traumatic brain injury | Active (positive) | 23 Feb 2007 |
| recombinant human C1-inhibitor EU/3/07/435 |
Prevention of delayed graft function after solid organ transplantation | Withdrawn | 20 Feb 2007 |
| ex-vivo cultured adult human mesenchymal stem cells EU/3/07/432 |
Treatment of graft-versus-host disease | Active (positive) | 20 Feb 2007 |
| artesunate EU/3/07/430 5 clinical trials → |
Treatment of malaria | Active (positive) | 20 Feb 2007 |
| idebenone EU/3/07/434 2 clinical trials → |
Treatment of Leber's hereditary optic neuropathy | Expired | 16 Feb 2007 |
| HLA class I/II binding tumour associated peptides (ADF-APO-CCN-GUC-K67-MET-MMP-MUC-RGS) EU/3/07/433 |
Treatment of renal-cell carcinoma | Withdrawn | 15 Feb 2007 |
| autologous dendritic cells pulsed with autologous tumour cell lysate EU/3/07/431 |
Treatment of glioma | Active (positive) | 15 Feb 2007 |
| Fenretinide EU/3/06/427 2 clinical trials → |
Treatment of soft tissue sarcoma | Withdrawn | 30 Jan 2007 |
| forodesine hydrochloride EU/3/06/428 |
Treatment of cutaneous T-cell lymphoma | Active (positive) | 29 Jan 2007 |
| thiotepa EU/3/06/424 11 clinical trials → |
Conditioning treatment prior to haematopoietic-progenitor-cell transplantation | Withdrawn | 29 Jan 2007 |
| Complement factor H EU/3/06/425 |
Atypical haemolytic uraemic syndrome | Withdrawn | 27 Jan 2007 |
| recombinant modified vaccinia Ankara expressing human 5T4 EU/3/06/429 |
Treatment of renal-cell carcinoma | Active (positive) | 26 Jan 2007 |
| Fenretinide EU/3/06/426 2 clinical trials → |
Treatment of primary malignant bone tumours | Withdrawn | 26 Jan 2007 |
| tazarotene EU/3/06/423 |
Treatment of congenital ichthyoses | Withdrawn | 18 Dec 2006 |
| forodesine hydrochloride EU/3/06/421 |
Treatment of acute lymphoblastic leukaemia | Active (positive) | 18 Dec 2006 |
| paclitaxel EU/3/06/422 400 clinical trials → |
Treatment of ovarian cancer | Withdrawn | 17 Dec 2006 |
| temsirolimus EU/3/06/420 4 clinical trials → |
Treatment of mantle cell lymphoma | Expired | 7 Nov 2006 |
| 4,7,10,13,16,19-docosahexaenoic acid EU/3/06/412 |
Treatment of retinitis pigmentosa | Active (positive) | 4 Nov 2006 |
| antisense oligonucleotide 5'-d[P-Thio] (CCCTG CTCCC CCCTG GCTCC)-3' EU/3/06/416 |
Treatment of acute myeloid leukaemia | Active (positive) | 3 Nov 2006 |
| ciclosporin EU/3/06/415 3 clinical trials → |
Prevention of rejection for corneal transplant | Withdrawn | 3 Nov 2006 |
| catumaxomab EU/3/06/414 |
Treatment of gastric cancer | Active (positive) | 3 Nov 2006 |
| Budesonide EU/3/06/413 11 clinical trials → |
Treatment of graft-versus-host disease | Active (positive) | 3 Nov 2006 |
| paclitaxel EU/3/06/419 400 clinical trials → |
Treatment of pancreatic cancer | Active (positive) | 31 Oct 2006 |
| recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule EU/3/06/411 |
Prevention of graft-versus-host disease | Withdrawn | 31 Oct 2006 |
| human cytomegalovirus immunoglobulin EU/3/06/408 |
Prevention of congenital cytomegalovirus infection following primary cytomegalovirus infection | Active (positive) | 31 Oct 2006 |
| heparin-binding epidermal growth factor-like growth factor, amino acids 74-148 EU/3/06/407 |
Prevention of necrotising enterocolitis | Active (positive) | 31 Oct 2006 |
| Iodine (131I) anti-tenascin monoclonal antibody 81C6 EU/3/06/418 |
Treatment of glioma | Withdrawn | 30 Oct 2006 |
| human interleukin-2 (glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) EU/3/06/417 |
Treatment of renal-cell carcinoma | Active (positive) | 27 Oct 2006 |
| doxorubicin hydrochloride EU/3/06/410 126 clinical trials → |
Treatment of soft tissue sarcoma | Active (positive) | 27 Oct 2006 |
| L-asparaginase encapsulated in erythrocytes EU/3/06/409 · now authorised as Graspa; Graspa |
Treatment of acute lymphoblastic leukaemia | Active (positive) | 27 Oct 2006 |
| genetically modified allogenic (human) tumor cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop i… EU/3/06/405 7 clinical trials → |
Treatment of renal-cell carcinoma | Active (positive) | 23 Oct 2006 |
| adenoviral vector containing human p53 gene EU/3/06/404 · now authorised as Advexin; Advexin |
Treatment of Li Fraumeni Syndrome | Active (positive) | 23 Oct 2006 |
| 5-(2,6-Difluoro-phenoxy)-3(R,S)-{2(S)-[2(S)-(3-methoxycarbonyl-2(S)-{3-methyl-2(S)-[(quinoline-2-carbonyl)-amino]-butyrylamino}-propionylamino)-3-methyl-butyry… EU/3/06/403 |
Treatment of neonatal brain injury | Withdrawn | 23 Oct 2006 |
| capsaicin - 10 clinical trials → |
Treatment of painful HIV-associated neuropathy | Negative | 21 Sep 2006 |
| tramadol hydrochloride - 8 clinical trials → |
Treatment of painful HIV-associated neuropathy | Negative | 21 Sep 2006 |
| opebacan EU/3/06/402 |
Treatment of meningococcal disease | Withdrawn | 28 Aug 2006 |
| N-methyl D-(2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate (tafamidis) EU/3/06/401 |
Treatment of familial amyloid polyneuropathy | Expired | 28 Aug 2006 |
| Metastable technetium 99 [99mTc] demogastrin 2 EU/3/06/400 |
Diagnosis of medullary thyroid carcinoma | Active (positive) | 28 Aug 2006 |
| mecasermin rinfabate EU/3/06/399 |
Prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age | Active (positive) | 28 Aug 2006 |
| H-Val-Ile-Val-Lys-Leu-Ile-Pro-Ser-Thr-Ser-Ser-Ala-Val-Asp-Thr-Pro-Tyr-Leu-Asp-Ile-Thr-Tyr-His-Phe-Val-Ala-Gln-Arg-Leu-Pro-Leu-OH EU/3/06/398 |
Treatment of myasthenia gravis | Withdrawn | 28 Aug 2006 |
| cholest-4-en-3-one, oxime EU/3/06/397 |
Treatment of amyotrophic lateral sclerosis | Withdrawn | 28 Aug 2006 |
Every row is copied from the EMA's orphan designations data, reproduced with acknowledgement of the source. Each substance links to its official EMA page.
A daily job downloads the EMA's orphan designations JSON report and lists every designation, newest first. No AI drafting and no editorial pass. See our editorial standards. The the EMA data on this page was last retrieved on 27 Sep 2026.